Cyberjunk
-
Posts
1,160 -
Joined
Content Type
Profiles
Forums
Events
Gallery
Posts posted by Cyberjunk
-
-
Work. But I flew back on Concorde! BA are doing a free upgrade for business class users in one direction and so I flew Concorde home. The flight was a mere 3hrs 20mins and was fantastic!
-
Quote Let's face it, most people will happily toe the line to save their job, nobody likes geting fired for being radical within a company... I have spent my working life being radical about things - hence I was bouncing up and down shouting about the web 7 years ago, and design and print stuff before that. And your right - it's not the best things to do! I am considered a loose cannon at the best of times at work but in my favour the company does prefer to have some armament! (some very good armament.) What I have hated though has been the career boys using my coat tails to 'get ahead'. I built, developed and ran our global company web site practically on my own for two years. There are now over 200 people involved in it and subsequent projects. I have got nothing out of it except a pat on the back. HOWEVER - I am not bitter (arrrghhh no no no
) but am quite happy with the knowledge that I really have made a difference. And to a certain extent we wouldn't have this site the way it is now (but needing an upgrade soon!) unless I had done what I did. As for politics my, and my recent brush with it (we won!), I quickly decided one must be passionately driven to get into it. And soon after all your aspirations are ground to paste by the bureaucracy involved... I will never stand for local council! (They are still checking my personal site everyday!!!)
</rant>
(damn spelling let me down again!!)
-
Apo-Stasis now has its own sub catagory under Cyberpunk 2020.
-
Key concepts: unnatural catastrophes, melting
glaciers, the Viridian Uncanny, Russian action movies,
Sergei Bodrov
Attention Conservation Notice: A weird, scary anecdote
about lethal climate change.
****************************************************
Entries in the Biofuture Robot Dog Contest:
From: Laura Sterling
http://www.viridiandesign.org/contests/laura.html
From: Mark Simpkins <mark*nodalpoints.org>
http://www.nodalpoints.org/viridian/index.html
From: Paul Jimenez <pj*place.org>
http://www.place.org/~pj/ROVER.txt
From: Giles Turnbull <giles*gorjuss.com>
From: david rice <david*futurefeedforward.com>
http://futurefeedforward.com/dingostroller.html
From: Duncan Stewart <stewarts*stewarts.org>
http://www.stewarts.org/viridian/gbn/watson.htm
From: David Bergman <bergman*cyberg.com>
http://cyberg.com/viridian/ddawg.htm
From: Eric Nehrlich <nehrlich*alum.mit.edu>
http://www.nehrlich.com/viridian_aromaker.html
"Here's my entry into the BioFuture Robot Dog Contest. No
fancy graphics, just an idea and some text, but what the
heck, it was fun to think about, and we'll see what other
people think. Thanks for the Viridian list == always
thought-provoking and interesting!"
From: "Matt Jones" <matt*blackbeltjones.com>
http://www.blackbeltjones.com/vonneumann
"My entry is 'Von Neumann's Best Friend.'
Matt Jones
http://www.blackbeltjones.com/work
"to have a great idea, you have to have lots of ideas"
Linus Pauling
This contest ends in six days: September 30, 2002.
**************************************************
Source:
http://www.planetark.org/dailynewsstory.cfm/newsid/17882/story.htm
"Hope fades for 80 missing in Russia mudslide
"RUSSIA: September 24, 2002
"VLADIKAVKAZ == Rescue workers in southern Russia
scrambled over a vast black tongue of muddy ice and
rubble, as hopes faded for 80 people missing since a
glacier roared down a remote mountainside, engulfing
villages.
"President Vladimir Putin said on television that a
third of the Maili glacier had broken free from the
Caucasus mountains late on Friday, causing a disaster
unlike any he could recall. (((Yeah: a glacier melts so
badly that a third of it, 20 million tons of ice, suddenly
breaks off and crushes everything in its path including a
film star. The galloping glacier was 500 feet high in
spots and moving at 60 miles an hour. That's pretty
memorable.)))
"Chunks of ice up to 100 metres (300 feet) thick
entombed the area around the village of Karmadon in North
Ossetia, a region on the northern edge of Russia's border
with Georgia.
"'The speed of the stream (of ice, mud and boulders)
was huge. There's no chance that any one in the area at
the time survived,' said Mikhail Razanov, deputy head of
the local Emergencies Ministry crisis unit told Interfax
news agency. (((Come to think of it, it must be pretty
demoralizing even to *survive* a "vast black tongue of
muddy ice and rubble" from a pursuing glacier. Imagine
the post-traumatic stress, and the difficulties of a
successful explanation. In other news, one 60-year-old
local man was found hiding safely in a cave.)))
(...) "Emergencies Minister Sergei Shoigu (((a great
name and title))) warned that meltwaters posed a new
threat, noting the last kilometre (0.6 miles) of the ice
had an estimated volume of 10-11 million cubic metres
(350-388 million cu ft). (((So it's still merrily melting
away, then.)))
"'If there is a sharp thaw, then we have to take steps
to evacuate people from the region who could be in the
disaster zone,' Russian news agencies quoted him as
saying. (((Well, at least they're not likely to re-settle
by other glaciers, because the planet is running out of
them.)))
(((Here comes the weird part.)))
Source:
http://www.cbsnews.com/stories/2002/09/24/world/main523137.shtml
"Film Star Missing After Avalanche
MOSCOW, Sept. 24, 2002
"(AP) Sergei Bodrov Jr. first seized the attention of the
world's film fans in 'Prisoner of the Caucasus,' and those
mountains may have brought him doom as well as fame. The
actor, seen by many as a prime hope for post-Soviet
Russia's struggling movie industry, is missing after an
avalanche roared through the site where he was working on
his latest movie. (((With any justice, this dead film
celebrity would become the long-sought "Rock Hudson of the
Greenhouse Effect," but well, you know, he's Russian.)))
"Officials on Tuesday held out little hope that more
survivors would be found from the devastation wreaked when
some 20 million tons of ice broke off a glacier and roared
down a mountainside. Newspaper reports of the disaster
featured large photos of the 30-year-old actor-director,
whose roles combining eros, honor and bewilderment seemed
to synopsize Russia's ambitions and troubles. (((Now he
personifies yet another Russian trouble: weather
violence.)))
"The avalanche in North Ossetia, a region of towering
peaks high in the Caucasus Mountains, left as many as 150
people dead. Sergei Shoigu, Russia's minister of emergency
situations, arrived in the town, about 940 miles southeast
of Moscow, for a firsthand look. Local officials have
declared Thursday a day of mourning.
"In addition to recovering bodies, workers were
working to restore the road from the town of Gizel to the
village of Kaban, which has been left totally isolated as
a result of Friday's avalanche. About 3,000 people there
are relying on helicopter drops of food and there is no
drinking water.
"Some 300 rescue workers were in the area, but there
was no news early Tuesday of more survivors being found.
"Officials said 49 people from the film crew or local
support staff were missing, while nine were safe == seven
who were not with the others and two who got out of the
disaster area. (((It's going to be tough for those two.)))
Sergei Bodrov's father, a famous film director, and his
wife also arrived in North Ossetia on Tuesday with Shoigu.
"Bodrov made his first movie in 1992, but it was four
years later that he riveted Russian and foreign viewers in
'Prisoner of the Caucasus,' which was directed by his
renowned father who now lives in the United States.
"The movie, based on Leo Tolstoy's novella of the same
title about two Russian soldiers taken hostage in
Chechnya, updated the tale to take place amid the war then
raging between Chechen separatists and the Russian army.
"Released in the United States as 'Prisoner of the
Mountains' == the title perhaps changed to avoid confusion
with a 1960s comedy that was one of the Soviet film
industry's most popular releases == was nominated for an
Academy Award and raised Russian cinephiles' hopes that
the industry was regaining its vigor after years of money
problems. (((Too bad the headline isn't "Oscar Winner
Slain by Greenhouse Effect." Close, but no such luck.)))
"The next year saw those hopes fulfilled == and the
Caucasus connection continued == with the release of 'The
Brother.' Bodrov played a disillusioned Chechnya war
veteran who becomes a lone vigilante in the crime-
festering cities of Moscow and St. Petersburg. (((Sounds
like prime video material for a viewing at the Viridian
Vatican. Incidentally, we're having a party here on
Saturday the 28th.))) Audiences identified with the
antiheroic role of a killer with morals and ideals and
critics hailed it as the first true movie of 'the New
Russia.'
"Bodrov's boyish looks, his full lips often set in a
tentative smile, seemed to emphasize the conflicting
currents of confusion and violence in the character.
"Bodrov 'is, in a certain sense, an image of our time,
a hero of our time,' Nikita Mikhalkov, director of the
international hit 'Burnt by the Sun,' said Tuesday on
Russia's ORT television. (((This may be the most famous
guy killed by the Greenhouse Effect.)))
"In 1999, he appeared in the French-made 'East-West'
with Catherine Deneuve, (((Oh what a near miss for
Catherine: "Deneuve Crushed On Set By Glacier")))
another Academy Award foreign film nominee and followed
that with 'The Brother 2,' which also got attention
internationally. His most recent foreign release was in
'Bear's Kiss,' again directed by his father, which
appeared at the prestigious Venice Film Festival this
summer.
"He further boosted his popularity at home by hosting
the television show 'The Last Hero,' a reality-based show
similar to the U.S. 'Survivor.' (((Imagine if Sergei had
been one of the two out of 50 or so in his film crew who
*survived.* What a publicity boom. Wow.)))
"Bodrov wrote and directed 2001's 'Sisters' and was at
work on his second production as director/actor/writer
when the avalanche hit.
"The newspaper Komsomolskaya Pravda said the movie's
working title was 'Svyaznoi' (Liaison), about three men
from different social strata who are in love with the same
woman. Bodrov chose the grim role of a garbage collector
with artificial legs who dies at the film's end. (((Only
in Russia, folks.)))
"In a headline combining references to the film and
his TV fame, the newspaper on Tuesday wrote 'Mysterious
premonition of the famous actor: Hero Bodrov would have
died in new film.'
"Bodrov and his wife Svetlana have two children, a 4-
year-old daughter and a son born in late August. (((Sorry
Svetlana, sorry kids. Really, truly. Maybe, someday soon,
the people will catch on.)))
O=c=O O=c=O
NICHEVO
O=c=O O=c=O
-
Cybergen is not my cup of tea as they say but its a good site - I just read through the Cybergen story so far and it looks like the players are enjoying themselves! Good work!
-
Key concepts: solar power, Sacramento, wind power,
Cape Cod, bad accounting, NIMBY groups
Attention Conservation Notice: Conveys the annoying,
dispiriting spectacle of green power advocates shooting
off their own feet.
****************************************************
Entries in the Biofuture Robot Dog Contest:
From: Laura Sterling
http://www.viridiandesign.org/contests/laura.html
From: Mark Simpkins <mark*nodalpoints.org>
http://www.nodalpoints.org/viridian/index.html
From: Paul Jimenez <pj*place.org>
http://www.place.org/~pj/ROVER.txt
From: Giles Turnbull <giles*gorjuss.com>
From: david rice <david*futurefeedforward.com>
http://futurefeedforward.com/dingostroller.html
From: Duncan Stewart <stewarts*stewarts.org>
http://www.stewarts.org/viridian/gbn/watson.htm
From: David Bergman <bergman*cyberg.com>
http://cyberg.com/viridian/ddawg.htm
"I've had my students submit entries for Viridian contests
before, but I've never put my electrons where my mouth is
'til now. So here goes."
David Bergman Architect/Fire & Water Lighting + Furniture
bergman*cyberg.com http://www.cyberg.com
This contest ends in one week: September 30, 2002.
**************************************************
Link: "Mr Fang" took snapshots at the festival.
http://www.waste.org/~alone/roundup2/
(((Welcome to many new Viridians who signed on
at the Texas Renewable Energy Roundup in Frederickburg.
Fun as that was, it may also help you newbies to realize
that life isn't always peaches and cream in the world of
green energy. Sometimes the advocates of wind and solar
can behave almost as remarkably as Enron, who, by the
way, were not participating at the Roundup this year.)))
Source: Sacramento Bee
http://www.sacbee.com/content/news/story/4289785p-5309526c.html
Story by Carrie Peyton Dahlberg
"Solar woes shock SMUD
Published 2:15 a.m. PDT Friday, September 6, 2002
"The showpiece of Sacramento's electric utility, an
internationally known solar power program, is in shambles.
"It has fallen short of its goals, rocketed past its
budget limits, lost its long-term chief and left
Sacramento Municipal Utility District directors scrambling
to figure out how to salvage their commitment to renewable
energy.
"The disarray could have far-reaching implications.
'For a long time, SMUD has been looked on as a leader ...
one of the nation's premier renewable energy programs,'
said Robert McConnell, a solar energy expert at the
National Renewable Energy Laboratory in Golden, Colo.
Other programs could face a harsher climate if SMUD starts
faltering and stumbling, McConnell said.
"But others said the impact of even major turmoil at
SMUD will be blunted because the solar industry has grown
and insiders have long been dubious about the utility's
efforts.
"'Everyone with a real knowledge of the industry knows
that SMUD's program is smoke and mirrors' and has promised
solar systems at unrealistic prices, said Tim Townsend, a
solar subcontractor who studied panel quality at a now-
defunct research center in Davis.
"Utility directors and managers say they remain
committed to keeping some kind of solar program. But as
internal audits showing the extent of the damage are
completed, they are not sure just what will be left.
"Already, SMUD has pulled the plug on any new
installations of solar panels at commercial sites for the
rest of 2002. It still will accept residential requests
this year for the panels, which convert the sun's heat to
electricity. But for 2003, nothing is certain == neither
the price of solar systems nor the pace of their
installation.
"'It's a really miserable situation,' said Genevieve
Shiroma, SMUD board president. ((("Genevieve Shiroma of
SMUD" == what a great California name.))) 'I'm really
shocked to hear that the program is basically in arrears.'
(((Maybe she should talk to some California utility and
natural gas companies.)))
"SMUD had planned to spend $3.2 million in 2002 to
help homeowners, businesses, government offices and
nonprofit groups install photovoltaic panels on their
rooftops or their grounds. Instead, Thursday night the
board authorized spending more than twice that, at least
$7.6 million. It has been warned the tally may need to be
upped to $9.5 million if SMUD cannot persuade the state to
switch its stance on a solar subsidy. (((A million here,
a million there, it adds up.)))
"And that money will buy much less than SMUD planned.
The utility will get only 60 percent of the way to its
2002 goal of putting up another 2 megawatts of
photovoltaic, or 'PV' systems. It will install only 1.1 to
1.2 megawatts.
"That slippage, and further setbacks expected next
year, will put SMUD well below the 15 megawatts of solar
power it once expected to have in place by 2003. (...)
"The troubles also have left the seven elected members
of SMUD's board wondering how things could have gone so
badly, for so long, without them knowing. (((Come on,
fellas.)))
"'Were these innocent mistakes, or were they
deliberate misrepresentations?' director Peter Keat asked.
(((Paging Ken Lay, paging Andy Fastow...)))
"'I would be reluctant to discuss that even in closed
session,' district general manager Jan Schori told him
during a committee session Wednesday. (((Shredders still
humming?)))
"Among the problems outlined for the board:
"The benefits of the solar program were double-counted
in budgeting, making the program appear $1.9 million
cheaper than it actually is.
"Solar panels cost far more than projected, partly
because of delays and financial problems of a manufacturer
that would have been SMUD's cheapest supplier. Higher
prices from other manufacturers, sometimes up to 90
percent over budget, combined with delayed purchases,
drove 2002 materials' costs $2.4 million over projections.
"Solar installations outside SMUD's area were
mistakenly priced below cost, in essence making SMUD
customers subsidize people in Davis and elsewhere.
(((No problem there; in the recents brownouts California
subsidized the entire natural gas industry.)))
"Contracts with suppliers were changed in violation of
board policy and without board approval.
"The district counted on qualifying for various grants
and subsidies that it didn't ultimately qualify for, and
that sometimes only existed as ideas outlined in pending
legislation. (((Paging Anderson Accounting.)))
"Several directors, who asked not to be named because
the discussions took place during closed sessions, (((oh
dear oh dear))) said they were deeply disappointed by the
actions of Don Osborn, who ran the solar program from 1991
until departing abruptly into early retirement in
February. (((Fall guy. Give 'em the gunsel.)))
"Osborn, who now runs his own company called Spectrum
Energy, said the board is 'probably only hearing one
side,' and that he had long urged against some of the
decisions that left the program where it is now.
'I served the district for better than a decade with
honor, and I brought honor to the district and to
Sacramento. We are at the forefront of the solar
revolution,' he said. (((Paging... Oh, go find
Exxon-Mobil's defense lawyers, they must be pretty
good.)))
(((Meanwhile, in Windville:)))
Source: Gallon Environment Letter
THE GALLON ENVIRONMENT LETTER
506 Victoria Ave., Montreal, Quebec H3Y 2R5
Email cibe@web.net
Vol. 6, No. 20, September 22, 2002
"ENVIRONMENTALISTS VS. ENVIRONMENTALISTS ON LARGE-SCALE
WIND POWER IN CAPE COD
"For decades environmentalists have been calling for
wind, solar and geothermal energy to replace coal, nuclear
and oil-fired energy. They said, let's move to
environmentally safer energy sources and get off of the
highly-polluting sources of nuclear and coal-fired
electricity. The environmentalists said let's reduce
greenhouse gas (GHG) emissions by going to energy sources
that don't produce GHG.
"Ironically, now that North America is moving into
large-scale, meaningful wind energy sources, some
environmentalists are opposing them too!! It's
environmentalists against environmentalists. The problem
is that you can't have your cake and eat it too. You can't
say no coal, no nuclear power, no oil-fired electricity,
unless you can provide an alternative, more benign energy
source. Sometimes environmentalists can go overboard and
become their own worst enemies. (((Really? Wow!)))
"Take for example, the proposed new Cape Wind project.
It is the first offshore wind park in the United States
which will be built on Horseshoe Shoal, five miles off the
Cape Cod shore in Massachusetts. The wind park will
consist of 170 wind turbines, spread over an area of
approximately five-by-five miles. When completed in 2005,
at peak output of the project will eliminate 4,642 tons
of sulfur dioxide, 120 tons of carbon monoxide, 1,566 tons
of nitrous oxides. The Cape Cod windfarm will reduce more
than a million tons of greenhouse gases, and 448 tons of
particulates from being dumped into the air from coal-
fired plants that the windmills would off-set.
"Yes, it is true that any human-made structure like
windmill farms will cause some disruption to the natural
environment. Yes, looking at 170 windmills may be awe-
inspiring, but not pretty. (((Uhm, yeah.))) But the true
environmental and health impacts are light-years lower
than the old energy sources that they replace. ((("Light-
years lower?")))
"The local environmentalists now opposing the
construction of the windfarm have gone too far. What do
they propose as an alternative to wind, solar and
geothermal? Are they proposing more coal and nuclear power
plants with their serious human toxics? Are they
advocating no energy growth at all? Do they want to have
the US import more oil from OPEC? Or do they just not want
the windmills 'Not In My Backyard (NIMBY) == but in
someone else's backyard?' (((Wait a minute, I think
we've found our answer!)))
"It's a bit selfish, given world efforts to reduce smog
and global warming. For more information on the wind
project contact Cape Wind Associates, 75 Arlington Street,
Suite 704, Boston, Massachusetts 02116, Phone: ph. 617-
904-3100, Fax 617-904-3109, email info@capewind.org . See
the Cape Wind Associates proposal at the website
********************************************************
"ALLIANCE TO PROTECT NANTUCKET SOUND IS FIGHTING WIND
MILLS
"The Alliance to Protect Nantucket Sound is the new
environmental group fighting the creation of the Cape Cod
wind farm. It is the one fighting efforts to reduce
greenhouse gas emissions and global warming. The
organization states that, 'the proposed location is in the
middle of the pristine natural area that defines the
region and is treasured by millions of people. People do
not come to Cape Cod to see an industrial power facility
on an empty horizon." (((Well, no problem; rising
Greenhouse seas or a Force-5 typhoon will take care of
that unseemly "pristine" quality.)))
"Wind industry has proven to be as destructive and
underhanded as any other power industry." (((Dang! Don't
that beat all!)))
"Further the group states that, 'people around the
world are challenging developers who cloak themselves in
the green armour of environmentalism while pocketing huge
profits and ruining the environment.' (((Yeah, they
probably are. In fact, there are lots of "protesters" who
go counter-gunning against protesters against Exxon-
Mobil.)))
"The organization has been able to enlist the help of
US Senator, John Warner of Virginia, who, they say, has
begun to question the wisdom of wind energy. (((Oh,
that's handy. A pet Senator from a coal-mining state.)))
"They report that Warner has asked the U.S. Corps of
Engineers to delay issuance of a permit for the first
phase of the Cape Code Wind Farm. What may be needed is a
high-level conference amongst environmental groups that
will resolve the environmental conflicts between those
advocating wind, solar and geothermal, and those opposing
it. Environmentalists cannot give mixed messages. (((Why
stop now?))) Nor should they defeat themselves over
efforts to clean up the environment and reduce global
warming. (((Why stop that either?))) For more information
contact the Alliance to Protect Nantucket Sound, 396 Main
St., Suite #2, Hyannis Massachusetts 02601, Phone:
508.775.9767, Fax: 508.775.9725. Email:
info@saveoursound.org . Visit their website at Visit their
website at http://www.saveoursound.org/willit.html .
O=c=O O=c=O O=c=O O=c=O O=c=O
RAMPANT PECULATION,
LUDICROUS WISHFUL THINKING,
PLAIN STUPIDITY,
OR BRILLIANT
INFORMATION WARFARE?
YOU MAKE THE CALL!
O=c=O O=c=O O=c=O O=c=O O=c=O
-
Key concepts: Metropolis magazine, sustainability
Attention Conservation Notice: an invitation
to green viewers and designers from "Metropolis,"
a magazine the Pope-Emperor reads faithfully.
Links:
http://www.time.com/time/roomba/index.html
The Roomba Robot Vacuum, a consumer emanation
from Rodney Brooks of MIT.
http://www.reemco.com/pets/catmantis.html
How have we lived this long without the
"Reemco Cat Mantis"?
****************************************************
Entries in the Biofuture Robot Dog Contest:
From: Laura Sterling
http://www.viridiandesign.org/contests/laura.html
From: Mark Simpkins <mark*nodalpoints.org>
http://www.nodalpoints.org/viridian/index.html
From: Paul Jimenez <pj*place.org>
http://www.place.org/~pj/ROVER.txt
From: Giles Turnbull <giles*gorjuss.com>
"Hi Bruce - my entry is up. - Giles"
From: david rice <david*futurefeedforward.com>
http://futurefeedforward.com/dingostroller.html
"I whipped up a little entry for the dog contest.
I've had some downtime before I begin my new job,
so I've started a futurefeedforward novel. I am also
the proud father of a newly built Linux system."
From: Duncan Stewart <stewarts*stewarts.org>
http://www.stewarts.org/viridian/gbn/watson.htm
"Well, the competition is looking good...a little too
good, in fact. I decided I'd better finish up now before
all the good ideas get published.
"I present to you Watson, the complete companion-
building system from your friends at <company as yet
unnamed>. A mixture of tried-and-true technologies
and pure speculation. But with the right financing...
crossing my fingers... Duncan Stewart"
This contest ends September 30, 2002.
**************************************************
Source: Metropolis magazine
"Newsletter of Metropolis Magazine 9/2002
"The Sustainable Metropolis
"At the beginning of this section, we invite viewers to
submit their sustainably designed projects for use on our
site. We're looking for houses and office towers, as well
as thoughtfully designed chairs, tables, or other
furnishings == all emphasizing environmentalism and
creativity. Please send your sustainable project,
including jpegs and a list of green features, to
Metropolis at talk2us*metropolis.com.
"Here are two very different, yet equally important
submissions:
"A Simple House in Washington, D.C.
"My wife, Julie, is an environmental policy researcher and
I am a partner at istudiodesign, a Washington, D.C.-based
collaboration of architects, designers, and planners
dedicated to the design of livable, sustainable
communities. We chose this house, our first, for
sustainable reasons."
http://www.metropolismag.com/html/sustainable/simplehouse.html
"Pharmacia Laboratory Building
"Green features need to be planned from the very start of
a project, not simply added as an afterthought. A pre-
design charette, hosted by Bill Browning of the Rocky
Mountain Institute, was held off-site with Flad &
Associates and other members of the design team, the
client, and the contractor. Careful use of sustainable
techniques and materials should save Pharmacia an
estimated $800,000 per year in energy costs."
http://www.metropolismag.com/html/sustainable/pharmacia.html
O=c=O O=c=O O=c=O O=c=O
SEE YOU SOON IN THE
METROPOLIS OF
FREDERICKSBURG, TX
O=c=O O=c=O O=c=O O=c=O
-
Key concepts: art, zero gravity, Gagarin Cosmonaut
Training Center, MIR campaign, Arts Catalyst, Leonardo,
Multimedia Complex of Actual Arts, Projekt Atol,
V2_Organisation, Spectre list
Attention Conservation Notice: Yes this Viridian Note
is out of order since 00337 has already been mailed.
Furthermore, this Note is about a far-out Russo-European
art scheme at a cosmonaut training center.
****************************************************
Entries in the Biofuture Robot Dog Contest:
From: Laura Sterling
http://www.viridiandesign.org/contests/laura.html
From: Mark Simpkins <mark*nodalpoints.org>
http://www.nodalpoints.org/viridian/index.html
From: Paul Jimenez <pj*place.org>
http://www.place.org/~pj/ROVER.txt
"Here's the rough verbage for a brochure that Lassiecorp
has planned: 'The ROVER Project.'"
This contest ends September 30, 2002.
**************************************************
Link: Renewable Energy Roundup this weekend! Be
there or be square, y'all.
http://www.renewableenergyroundup.com/
Source: Spectre list
http://coredump.buug.de/cgi-bin/mailman/listinfo/spectre
From: Anne Nigten <ANne*v2.nl>
Date: Wed Sep 18, 2002 11:08:18 AM US/Central
To: spectre*mikrolisten.de
Subject: [spectre] MIR Campaign: Opportunity
for Art or Science Projects in Variable Gravity
"MIR Campaign
"OPPORTUNITY FOR ART OR SCIENCE PROJECTS IN VARIABLE
GRAVITY (INCLUDING ZERO GRAVITY)
"and OTHER ARTISTIC PROJECTS at the GAGARIN COSMONAUT
TRAINING CENTRE
"Call for Proposals = deadline 21 October 2002
"The MIR partnership invites proposals from European
and Europe-based artists and scientists to undertake
projects/research in variable gravity conditions on a
parabolic flights or using other facilities, such as the
centrifuge and the hydrolaboratory/neutral buoyancy
facility used for EVA training, at the Gagarin Cosmonaut
Training Centre (GCTC), Star City, Russia.
"A parabolic flight provides up to 20 cycles of 30-
second periods of weightlessness (zero gravity and
microgravity) in freefall, interspersed with periods of
double gravity (2g acceleration) and normal gravity.
"This is the pilot project of the MIR (microgravity
interdisciplinary research) initiative, which seeks to
open up space and space industry related facilities by
matching artistic processes and scientific research to
give a new impulse to space art and space research.
"The MIR partnership comprises 5 European art
organisations focusing on art, science and technology:
"The Arts Catalyst, science-art agency, London, UK
"Leonardo/Olats, Leonardo journal of art, science &
technology and Leonardo observatory for the arts and the
techno-sciences, Paris, France
"Multimedia Complex of Actual Arts, Moscow, Russia
"Projekt Atol, arts-technology organisation, Ljubljana,
Slovenia
"V2_Organisation, institute for the unstable media,
Rotterdam, Netherlands
"The selection committee will be made up of
representatives from these organisations.
"The opportunity includes a cultural exchange and working
trip to Moscow and Star City in early 2003, including the
potential to participate in one or two parabolic 'zero
gravity' flights with the GCTC.
"The opportunity is open to artists and scientists in
any discipline, where the lead proposer is based in any
European country, whether or not EU members. We will
select up to 6 artists' projects and up to 3 scientific
experiments for participation.
"For information and proposal form, go to:
"Please email your intent to make a proposal as soon as
possible to :
"The MIR initiative is supported by the European Union's
Culture 2000 fund."
O=c=O O=c=O O=c=O
HEY WAIT A MINUTE:
HOW COME THE USA
DOESN'T HAVE ANY
STATE-SUPPORTED
SPACE ART?
O=c=O O=c=O O=c=O
-
Key concepts: climate change, drought, El Nino,
North America
Attention Conservation Notice: Imminent warfare
hogging headlines as American heartland fries
and parches.
****************************************************
Entries in the Biofuture Robot Dog Contest:
From: Laura Sterling, age six
http://www.viridiandesign.org/contests/laura.html
From: Mark Simpkins <mark*nodalpoints.org>
http://www.nodalpoints.org/viridian/index.html
"Here is my entry for the Biofutures robodog contest.
These few words sum up the principles of my ideas.
i thought i would send it in now as you don't seem to be
having many entries yet (sure they will come along though).
Yes i want one of my robodogs for my son...
thanks mark"
This contest ends September 30, 2002. That's less
than two weeks! How hard can a fake dog be?
**************************************************
Source:
http://www.planetark.org/dailynewsstory.cfm/newsid/17757/story.htm
Story by Randy Fabi
"US summer of 2002 is hottest since 1930s Dust Bowl
"USA: September 16, 2002
"WASHINGTON == With nearly half the country reeling from a
blistering drought, this summer is the hottest since the
depression-stricken 'Dust Bowl' era of the 1930s, U.S.
government weather experts said last week.
"The summer's scorching temperatures have sparked
raging forest fires in the West, wilted crops in the
Midwest and parched pastures in the Plains.
"The National Oceanic and Atmospheric Administration
said the average temperature for the contiguous United
States from June through August was 73.9 degrees (23.3
degrees Celsius), the third hottest summer since records
began in 1895. Summer officially ends on Sept. 22.
"The only summers warmer were 1936 and 1934, when vast
numbers of farmers were driven from their land by drought.
"'It's very extraordinary to have the warmest summer
since the 1930s Dust Bowl days,' said Douglas LeComte,
drought specialist for NOAA's Climate Prediction Center.
(((I suppose he feels he has to say that, but surely it's
not surprising him much.)))
"Although the U.S. economy is no longer as dependent
on agriculture as it was in the 1930s, a major drought two
years ago caused damage worth $4 billion and claimed 140
lives nationwide. That summer in 2000 was only the 12th
warmest on record.
"'Although the total costs of this year's drought are
not presently known, the drought-diminished water
supplies... and contributed to an active wildfire season
and extremely difficult farming conditions,' NOAA said.
"Moderate to extreme drought covers more than 45
percent of the United States.
"UNPRECEDENTED DROUGHT IN 6 STATES
"Six states == North Carolina, Virginia, Colorado,
Utah, Arizona and Nevada == are suffering their worst
drought on record, NOAA said. South Carolina, Maryland,
Georgia, Delaware and Wyoming are also near unprecedented
dry levels.
"The prolonged drought has scorched U.S. wheat, corn
and soybean crops, which will be the smallest in years.
More than 50 percent of pastures were classified as poor
to very poor in 24 states, leaving ranchers with little to
feed their livestock.
"So far this year, South Dakota officials have
reported over $1.8 billion in agricultural losses, while
Texas claims $316 million in damages. Costs to fight
forest blazes this year are expected to amount to more
than $1.25 billion, government officials said. (((As the
forests decline from heat stress and booming pest
populations, Americans will finally be persuaded that it
makes good sense to log our national forests down to
bedrock if they are going to burn up anyway.)))
"'NOAA officials predicted the direct loss of this
year's drought would certainly be in the billions of
dollars. (...)
"The Democratic-led U.S. Senate on Tuesday voted
overwhelmingly to provide drought relief of $6 billion to
farmers and ranchers despite objections from the Bush
administration.
"The most extensive national drought in the past 100
years was in 1934 when it hit 80 percent of the country.
Studying tree ring records, NOAA researchers said the
severity of the 1930s drought was likely surpassed only in
the 1570s and 1580s." (((Well, there's a record to look
forward to.)))
O=c=O O=c=O O=c=O O=c=O O=c=O O=c=O O=c=O O=c=O
"AND SO, WHILE THE END-OF-THE-WORLD SCENARIO
WILL BE RIFE WITH UNIMAGINABLE HORRORS, WE BELIEVE
THAT THE PRE-END PERIOD WILL BE FILLED WITH
UNPRECEDENTED OPPORTUNITIES FOR PROFIT"
O=c=O O=c=O O=c=O O=c=O O=c=O O=c=O O=c=O O=c=O
-
OK - moved to general. Please nobody get racial on this. Fundamentalist nutters aside muslims are great people. Britain has always been a multicultural society. The BBC did a dna survey across the whole of the British Isles looking for where the Vikings were and discovered that most of us have Viking DNA, and Angle and Saxon and Jute and Dane and roman and Norman and and and... So the white Brit is already multi cultural.
-
OK - moved to general. Please nobody get racial on this. Fundamentalist nutters aside muslims are great people. Britain has always been a multicultural society. The BBC did a dna survey across the whole of the British Isles looking for where the Vikings were and discovered that most of us have Viking DNA, and Angle and Saxon and Jute and Dane and roman and Norman and and and... So the white Brit is already multi cultural.
-
Key concepts: 802.11 networking, pedal power,
appropriate technology, Laos
Attention Conservation Notice: If it's so great
for the Third World, how come rich people aren't
using it already?
Links: Want to see me keep blogging? Buy an
Ursula Le Guin embroidered lunchbag.
How It Works:
http://www.infinitematrix.net/faq/fundfest-how-it-works.html
Donor Rewards:
http://www.infinitematrix.net/faq/fundfest-rewards.html
Schism Matrix weblog:
http://www.infinitematrix.net/columns/sterling/
****************************************************
Entries in the Biofuture Robot Dog Contest:
One. By Laura Sterling, age six, who remarks:
"I want a robot dog, but I'd rather have a robot
pig." Unless we Viridians start seeing some entries,
this small, daring child is going to waltz off with
your robot.
http://www.viridiandesign.org/contests/laura.html
This contest ends September 30, 2002.
**************************************************
Link:
http://www.RenewableEnergyRoundup.com/
We Viridians will have some solar UFOs, some Viridian T-
shirts, and issues of the Viridian WHOLE EARTH magazine.
Come say howdy.
http://www.whoi.edu/institutes/occi/iceage.html
Scarifying, eye-popping Woods Hole warning about
a sudden switch in ocean currents. If Europe freezes
solid, where will all the heat go? Texas, I'd assume.
http://www.guardian.co.uk/worldsummit2002/story/0,12264,786221,00.html
When it comes to global climate, these countries
contain the world's public-spirited, decent people.
"Support for the proposal came from all 15 EU states,
Norway, Iceland, Switzerland, Poland, Hungary, the Czech
Republic, Romania and Slovakia, Brazil, Argentina, Uganda,
Mexico and other Latin American states, plus some
Caribbean and Pacific islands." Tough break about
the rest of us.
Sources: Australia Internet, article by Craig Liddell
http://australia.internet.com/
80211 Planet
planet.com/columns/print/0,,1781_1454991,00.html
"Pedal Power: Look Ma No Wires
By Craig Liddell
"An innovative, pedal powered, wireless network provides
Internet access to off-grid villages in Laos. (((Pedal-
powered wi-fi. Okay, that's hard to beat Viridian-
wise.)))
"Jhai PC is a project of non-government organisation
(NGO), Jhai Foundation.
"'The equipment will be powered by electricity stored
in a car battery (((yuck))) charged by 'foot cranks',' Lee
Thorn, Jhai Foundation chair, explains. These 'are
essentially bicycle wheels and pedals hooked to a small
generator. The generator is connected to a car battery and
the car battery is connected to the computer.' (((At
least car batteries are plenty available.)))
"'Connection with each computer to the others will be
by radio local area network (LAN),' he says. 'Each village
will connect to one repeater station powered by a solar
means on the ridge near the river valley. That station
will then send the radio signal to the microwave tower
nearby and eventually to a server in Vientiane that will
connect the villages to the Internet.
"The key message of Jhai, which means 'hearts and
minds working together,' is reconciliation. Laos is one of
poorest countries in the world and, on a per capita basis,
the most bombed place on Earth. Bounthanh Phommasathit, a
co-founder of the organisation, was forced to flee her
ancestral home in the Plain of Jars in Laos following the
American bombing campaign during the Vietnam War. Thorn,
the other co-founder, loaded several of the bombs that
fell on the Plain of Jars while serving on the USS Ranger,
an aircraft carrier. (((And let me guess further: Ms.
Phommasathit and Mr. Thorn got married and have three
lovely children now.)))
"(...) Each village will have a Jhai computer
connected in a network with the other villages that
connects to the Internet and to their high school-based
Internet Learning Centres (ILC). (((How about that pedal-
powered porn and spam?)))
"The Jhai computers will also provide them with the
opportunity to do simple business functions like writing
documents and creating spreadsheets for budgetary and
simple accounting purposes. (((Write a novel, lose 20
pounds.)))
"Lee Felsenstein is a member of the Jhai Board of
Advisors and project engineer for the Jhai communication
project. He, and fellow engineer Mark Summer, are
volunteering their time. Felsenstein has a long history of
public advocacy and was a co-founder of The Community
Memory Project, a non-profit organisation that developed
public-access information-exchange systems beginning in
1972. He also designed one of the first portable computers
for Osborne in the early 1980's."
Link:
http://www.computerhalloffame.org/pagetwo.html#Fels
Lee Felsenstein doesn't kid around; he's in the
"Computer Hall of Fame."
"'The Jhai PC is built of 'embedded' circuit boards,'
says Felsenstein, (((geeking fluently))) 'of the sort that
are used in industrial equipment. These are rugged and
devoid of moving parts such as fans or disc drives, made
to operate for long periods of time without service or
attention. The Jhai computer consists of a single-board PC
(the MZ-104 based upon the Mach-Z single-chip computer ==
equivalent to a 133 MHz 486 system).' He has analysed the
'Internet appliance generation of chips and found this to
be the best, especially for its low power consumption and
remote BIOS reboot capability.'
"The software is LINUX-based (((woot!))) and is being
localised into the Lao language by Anousak Souphavanh and
his team in New York. (((Laonux))) The system is being
configured to provide a 'telegraph' (email) and telephone
(VOIP communication) among the villages, via the Lao phone
system, and worldwide through Internet telephony.
"'Along with the processor,' Felsenstein continues,
'is an adapter card for PCMCIA cards, allowing us to use
the Cisco Aironet 350 Wi-Fi (802.11b) wireless LAN card. A
Sound Blaster compatible sound card completes the board
complement. The three boards, together with a connector-
panel board fit together in a compact 'stack' and have no
case or power supply. We will build our own case, using a
commercially available die-cast metal housing which will
seal the boards from the external environment and still
allow heat to transfer out.' (((Hey! Where's mine?)))
"'The system includes a regulator which doubles as a
battery charger,' he says, 'and can operate from a wide
range of voltages. We plan to use stationary bicycles
equipped with generators for charging the batteries. The
mountaintop relay stations will have solar panels for
power, (((yowza))) and we hope that the villages can also
have them, though they are expensive.'
(...) "'This is a world pilot project,' says Thorn, 'We
expect to document it extensively. We see it as stage one
of a project to link villagers in remote areas to each
other and to people like us who are interested in Lao
villagers' success in meeting their own and Lao PDR's
goals. We expect that Jhai Foundation and especially our
Lao consultants will report on this experience to
interested parties, first, in Lao PDR, and second,
elsewhere.'" (((How about down in the local gym? They're
pedalling anyway.)))
Source: Solaris list, Steve Cisler
Date: Tue, 3 Sep 2002 09:34:58 -0700
Subject: Re: [solaris]Pedal Power: Look Ma No Wires
To: henk <henk@waag.org>
From: Steve Cisler <cisler@pobox.com>
"I'm involved in this wireless project in a peripheral
way. I attended the design review in San Francisco a few
weeks ago. It was a mix of board members, volunteer
experts, and Jhai members. I am doing due diligence
research on alternate methods of providing services
(telephony is the top priority, not the Internet). Lee
Felsenstein, a pioneer in community technology (look up
Community Memory Berkeley in Google) is doing a lot of the
design work. I think it is a strong design, sensitive to
the input garnered from the communities' work on a ten
year vision plan, as well as his own experience with hw/sw
design. The pedal device is from India (I believe), but
it could be powered by solar or gas generator. The idea is
that young people will earn money /computer time pedaling
the device. We estimate it will take about one hour of
labor to re-charge the battery for 4 hours of
computer/printer/lcd screen use. Everything is designed
for the high humidity environment. And it's also dusty.
We are considering physical security of the devices too.
"The whole issue of whether custom hardware will
flourish from an economic standpoint has been discussed
when talking about the Simputer and Volkscomputer. It's
one Jhai is aware of. The network connection is very
complex from a political and technological standpoint, and
we are working on that now. I'll post more information
later this year. However, ideas for funding this are most
welcome. Others involved in this project are on this list
and may wish to comment."
Steve Cisler
http: home.inreach.com/cisler
O=c=O O=c=O O=c=O
PUFF PUFF PUFF
OH LOOK IT'S RUNNING
JAVA <GROAN>
O=c=O O=c=O O=c=O
-
Key concepts: European floods, Earth Summit,
Gerhard Schroeder, green energy, Greening
Earth Society, denial industry, black
propaganda
Links: GBN/Viridian Spokesmodel Tina Estes
offers useful links for interested parties
intrigued by biofutures.
http://www.thenextindustrialrevolution.org/
http://www.saffo.com/sensors.html
http://www.symyx.com/sy_mater-markt.html
Entries in the Biofuture Robot Dog Contest:
None. We do, however, seem to be getting
a large number of web-hits on the contest page
from people who have never before been in a
Viridian Contest. They want to know how to enter.
It works like this:
A. You create your entry and put it
on a website somewhere. If you have no
website and have no idea how to post
things on the Web, forget about it,
for you are not Viridian, you are already
a d00med l0ser.
B. You tell me, bruces@well.com,
where the website is.
C. I post the address to the Viridian List.
D. The judges decide who wins.
E. Eventually the entries end up in the
Viridian Contest Repository.
Go have a look at all the other
contests. Come on, you can
beat those people, you newbies.
Show some self-esteem here.
http://www.viridianrepository.com
Link:
http://www.RenewableEnergyRoundup.com/
This charming Fredericksburg event happens
in just two weeks. The Pope-Emperor is
going and we will have a Viridian Outreach
table there. Drop by and check out the
toys, gizmos, agitprop and blobjects.
(((Central Europe drowned this summer.
The flood damage busted national government
budgets. An interesting harbinger of a
world becoming uninsurable, and some of the
injured parties are speaking out.)))
Source:
http://www.planetark.org/dailynewsstory.cfm/newsid/17556/story.htm
"Schroeder calls energy conference in Germany
SOUTH AFRICA: September 3, 2002
"JOHANNESBURG == German Chancellor Gerhard Schroeder told
delegates at the Earth Summit yesterday Germany was ready
to host an international conference on renewable energy.
'I will send out invitations to an international
conference on renewable energy in Germany.
"'We want to supplement what we achieved at the end of
last year at the Bonn water conference in the field of
energy,' he said in a speech to the World Summit on
Sustainable Development in Johannesburg.
"He gave no further details of the meeting. Germany
organised an international fresh water conference in Bonn
last December, where delegates reiterated pledges to
provide adequate supplies of drinking water worldwide.
"Schroeder referred to last month's dramatic flooding
in Germany, the Czech Republic, Austria and China. The
floods, which killed dozens in Europe and hundreds in
China, were blamed by some on global warming caused by
burning fossil fuels.
"'Climate change is no longer a sceptical prognosis,
but a bitter reality. This challenge demands decisive
action from us,' Schroeder said.
"He said the Earth Summit should pressure states to
ratify the Kyoto Protocol on climate as quickly as
possible so that it can come into force this year. He also
appealed to nations such as the United States, Canada and
Australia to make some contribution to climate
improvement.
"'For those industrialised countries that have not
signed up, I appeal to them at least to contribute to an
equivalent reduction of greenhouse gases,' Schroeder said.
(...)
(((If climate change is "bitter reality" and getting
bitterer fast, are there still people in the denial
business? Oh yes. There's the Greening Earth Society, a
tool of American coal interests and a Viridian bete noire.
Note relentless political attacks on American public
figures admitting the truth.)))
Source: Greening Earth Society
http://www.co2andclimate.org/climate/
http://www.co2andclimate.org/Articles/2002/vca26.htm.
"VIRTUAL CLIMATE ALERT
"August 29, 2002 Vol. 3, No. 26
"Maryland's outgoing Democratic governor Parris N.
Glendening, Tuesday, August 27th, announced mandatory
water restrictions across much of the state in response to
the major drought that grips mid-Atlantic states from
Georgia to Pennsylvania. The drought is so severe that
even with the rains of the last few days, many folks 'hope
for a hurricane' to deliver much-needed, prolonged, and
widespread soaking.
"But Glendening didn't stop there. Not satisfied with
articulating his government response to the drought, he
proclaimed its cause. Of course, it's global warming.
"What is curious to us is how Gov. Glendening apparently
is willing to link the drought to global warming while
scientists trained in climatology and meteorology and who
have dedicated their careers to a study of these fields
are reluctant (or lack sufficient political ambition) to
join him out on that limb. Here's why. (((Because we pay
them to.)))
Read this Virtual Climate Alert in its entirety at
http://www.co2andclimate.org/Articles/2002/vca26.htm.
N.Y. Times to Facts: Drop Dead!
"Maybe the heat prostrates dowager New York Times late in
the summer. Two years ago, it carried a breathless front
page story about the melting of the polar ice cap, only to
retract it a few weeks later (on page C-18) when
confronted with the historical record of polar
temperatures. (((Uh, not really.))) On August 28 of this
year, thanks in part to a dissonant convergence of climate
stories == drought in New York, yet another U.N.
environment confab, this time in Africa, evil President
Bush refusing to wreck our economy with the Kyoto Protocol
== the Times published a real lulu headlined 'Forecast for
the Future: Deluge and Drought.'"
"World Climate Report's editors walk through the facts of
the matter concerning frequency of severe European
flooding and trends in U.S. drought, and changes in the
rate of East Coast evapotranspiration and Asian rainfall.
You can read the entire story at
http://www.co2andclimate.org/climate/v8n01/feature.htm.
"Climate Model Lapse
"The 'Great Debate' (((there is no debate == there are
facts versus industrial interests))) in climatology these
days focuses on the differences between two temperature
records: surface and satellite. The problem is this:
Thermometer readings from across the planet's surface are
warming at a greater rate than satellite temperature
measurements of the lower atmosphere, or troposphere. That
difference is probably real and not a result of errors in
the data sets, since the satellite record is a measure of
the temperature of the overlying atmosphere and not the
surface. Meteorologists call the difference between the
surface readings and those from the overlying atmosphere
the "lapse rate," a term that refers to the rate at which
temperature declines with height."
If climatologist don't understand the reason for the lapse
rate, are the climate models capable of winkling out the
answer? Read the facts of the matter
athttp://www.co2andclimate.org/climate/v8n01/hot.htm.
Ned Leonard
Executive Director
Greening Earth Society
333 John Carlyle Street, Suite 530
Alexandria,VA22314
(703) 684-4748 Phone
(703) 684-6297 Fax
O=c=O O=c=O
CRIME PAYS
O=c=O O=c=O
-
A Personal Message (PM) would probably work better in situations like this.
For those who have not found all the features of this forum have a look in 'Your Control Panel' at the top of the page - only available when you have logged in. People get PMs as soon as they log in.
-
Quote (malek77 @ Sep. 09 2002,09:21) 010000110100000101000011010000010100000101000011010001110100001101010100010001110100000101
000001010001110101010001000001010000010100001101000111010000110100000101000011010000010101
010001000111010101000101010001000111010001110100001101000001010000010100001101000111010000
010100001101000011010001110100001101000001010000010100001101010100010001110101010001000001
010000010101010001000111010001110100011101010100010001110101010001000011010001110100001101
000001010000010101010001000111010001110101010001000111010000010100001101000111010000010100
001101000011010001110100001101000001010000010101010001000111010101000101010001000111010000
010100000101000111010000010101010001000111010001110100000101010100010000010100001101000001
010000010100001101000011010001110100011101010100010001110100001101000001010101000100000101
000001010000010101010001000111010101000101010001000111010001110100000101000111010001110101
010001000011010001110100000101000001010000010101010001000111010001110100001101010100010001
110101010001000011010001110100001101000001010000010101010001000111010000010100001101000011
010001110100011101000011010000010100001101000001010000010101010001000111010001110101010001
000001010000010100011101000011010000010100001101000011010001110100011101000011010000010100
000101000111010001110100011101010100010000010100011101000001010000010101010001000111010001
110100000101010100010000010100001101000001010101000100000101000111010101000100000101000111
010101000100000101000111010000010100001101000001010001110101010001000001010001110100001101
000011010000010100001101000001010000010100011101000011010000010100000101000111010000010100
001101000011010001110100001101010100010001110100001101010100010001110100000101000111010000
010101010001000111010000010100000101000111010000010100000101000001010000010101010001000111
010001110100000101000111010001110101010001000011010001110100000101000001010000010101010001
000111010001110100000101010100010000010100001101000011010001110100011101010100010000010100
001101000011010000010100011101000001010000010100001101000001010000010101010001000001010000
010101010001000111010001110100001101000001010001110101010001000011010000010101010001000111
010000010100000101000001010000010100000101000111010000010100011101000001010001110100000101
000001010001110100011101000011010000010100001101000001010000010101010001000111010001110100
001101000001010000010100001101000111010000010100000101000111010001110101010001000001010000
010101010001000111010001110101010001000011010001110100000101000001010001110100001101000001
010101000100000101000111010101000100000101000111010101000100000101000111000011010000101000
000000TCATTTTCATCATTTTTTTCATTTTCATTTTTTTCATCATCATCATTTTCATTTTTTTCATTTTCATCATCATCATTTTTTTCATCATCA
TCATTTTCATTTTTTTCATTTTCATCATCATCATTTTTTTCATTTTCATCATCATCATTTTTTTCATCATCATCATTTTCATTTTTTTTT
TCATTTTTTTTTTCATTTTTTTTTTCATTTTTTTTTTCATTTTTTTTTTCATTTTTTTTTTCATCATTTTCATCATCATCATTTTCATCA
TCATCATCATCATCATCA
-
Key concepts: Doors of Perception conference,
Amsterdam, Natalie Jeremijenko, robot dogs,
flows
Links: GBN/Viridian Spokesmodel Tina Estes
temptingly displays the Sony Aibo prize for our
latest Viridian Design contest.
http://www.viridiandesign.org/images/robodog4.jpg
http://www.viridiandesign.org/notes....st.html
Semi-licit Aibo hacking. Don't look at us Viridians,
it isn't our fault:
http://www.generation5.org/aisolutions/rob04.shtml
Entries in the Biofuture Robot Dog Contest:
None yet, but check out this bit of Koestlerian
synchronicity from former Viridian contest judge
Dr. Natalie Jeremijenko.
Links:
http://www.geneart.org/jeremijenko.htm
http://jove.eng.yale.edu/twiki/bin/view/Main/NatalieJeremijenko
http://www.viridiandesign.org/notes....ue.html
http://www.viridianrepository.com/neologue/neologue.htm
Natalie Jeremijenko remarks:
"My robot dog adaptation pages:"
http://jove.eng.yale.edu/feralrobots
and
"It's a project I have been working on for about a year
now, in typical no-funding way. The radioactivity dog is
done and being deployed in November in some post Chernobyl
fallout regions by a bunch of Norwegian highschool
students, fingercrossed. I have a few students working
this semester on the organic solvent and carbon monoxide
dogs. It took me a year to convince my institution to let
me set these dogs on the students.
"Then you come in to invite hundreds, no thousands of well
paid, underworked corporate and anticorporate types to
jump all over the dog redesign game.... Or maybe to create
lots of interest/material/willing participants and dog
adaptation recruits. Not sure if you are wiv me or agin
me! Anyway, it is surprising how coincident you and I can
be. I thought I was secretly redeploying my feral robotic
dogs as secret agents.
"I think I will see you at Doors? your co-conspirer, n"
(((Why yes Professor Jeremijenko, I will indeed be at
Doors of Perception this year.)))
Links:
http://www.doorsofperception.com/Magazine
http://flow.doorsofperception.com/
"The design challenge of pervasive computing
14, 15, 16 November 2002 in Amsterdam
"Flow
"'Everything flows' said Heraclitus. But we have filled
our world with complex technical systems == on top of the
natural systems that were already here, and
social/cultural ones that evolved over thousands of years
== without thinking much about the consequences. Some of
these consequences, as a result, include environmental
decline and poor social quality. So we need to start
thinking proactively about the design of complex systems
and flows == particularly as we pervade the world with
smart systems and ambient intelligence.
"We open the conference with a review of the natural,
human and industrial systems that we live among: how they
are doing? how they are interacting with each other? We
then explore the ways in which flows are a design issue.
What are the implications of a world filled with sensors
and actuators? What will it mean it to be 'always on' in a
real-time economy? To what question, is pervasive
computing an answer?
"In order to do things differently, we need to perceive
things differently. On Day 2 we therefore ask, how shall
we design ways to perceive, experience and understand
flows? What does the world as spreadsheet look like? How
do you design a global company’s 'dashboard'? Do we only
design visualizations of flows, or do we design for all
the senses, and experience flows through performance?
"On Day 3 we look at the design process in the space of
flows == and what it means to move from designing things,
to designing systems. When computers disappear, what then
will we design? How do we move from a project model, to a
continuous model of design? In what ways are games,
simulations and play appropriate modes of designing flows?
"The conference combines short, punchy presentations == by
thirty thought-leaders from around the world - with panel
discussions, and interactions among you, the participants.
Flow Breakfasts for small special interest groups take
place on Days 2 and 3.
"Doors of Perception
"Doors is a conference, website, knowledge network, and
cultural accelerator.
"We bring together innovators, entrepreneurs, educators,
and designers who want to imagine alternative futures ==
sustainable ones == and take design steps to realize them.
"Doors brings together the actors and the thinking that
will influence social, cultural, technological and
theoretical design decisions in the years ahead. Design
decisions which are process decisions in a media and
network saturated environment, where the computer has
disappeared as visible technology. When the computer
disappears the environment becomes the interface. We might
understand this as a move from content management towards
context-management. Yet: what does it mean to manage the
design of context?
"Speakers confirmed so far
"The programme will feature 30 presenters together with
invited panellists, moderators, and you, the conference
participants.
Ben van Berkel and Caroline Bos, UN Architects, The
Netherlands
J.C. Herz, Joystick Nation, USA
Ivo Janssen, pianist, The Netherlands
Ezio Manzini, author of The Material of Invention, Italy
Malcom McCullough, author of On Digital Ground, USA
Aditya Dev Sood, Centre for Knowledge Societies, Bangalore
Philip Tabor, architect and writer, Italy
Bruce Sterling, leader of the Viridians, USA
Patricia de Martelaere, philosopher, writer, university of
Brussels, Belgium
Stefano Boeri, architect and urban planner, Italy
Felix Stalder, cofounder of openflows.org, Canada
Ole Bouman, editor of Archis magazine (who are publishing
a special issue on Flow for the conference), The
Netherlands
Franziska Nori, curator of the I love you virus exhibition
at Frankfurt's MAK, Germany
Marco Susani, director of the advanced concepts group at
Motorola Consumer Experience Design, USA
Felice Frankel, research scientist at MIT, USA
Ton van Asseldonk, advisor about change to large Dutch
enterprises, The Netherlands
Natalie Jeremijenko, engineer in the Center for Advanced
Technology, New York University, USA
Joshua Davis, designer of praystation.com, USA
Louis Fernandez-Galiano, author of Fire and Memory: On
Architecture and Energy, Spain
Axel Thallemer, founder and head of Festo Corporate
Design, Germany
Peter Boegh Andersen, Computer Science, Aalborg
University, Denmark
Janine Benyus, author of Biomimicry, USA
Derrick de Kerckhove, director of the Mc Luhan Program in
Culture and Technology, Toronto, Canada
Gill Wildman and Ellie Runcie, design managers at the
Design Council, UK
Doors 7 Programme At A Glance
Thursday 14 November
11:30 Registration opens.
13:00 Conference begins
19:00 Ivo Janssen performance
19:30 Conference reception
Friday 15 November
08:00 Flow Breakfasts (by registration)
09:00 Bookshop and club-room open all day
09:30 Conference begins
1700-1900 Open Doors/ Design Grand Prix
Saturday 16 November
08:00 Flow Breakfasts (by registration)
09:00 Bookshop and club-room open all day
09:30 Conference begins
17:00-18:00 Large Doors panel
21:00 Conference Party (attendance is compulsory)
"People are losing their jobs: how do I justify coming to
Doors?
"One reason we face economic problems now is that the
technology-driven model of innovation has failed. People
participate in Doors when they need to imagine sustainable
and engaging futures == and take design steps to realize
them. Doors helps people and organisations look at the
world in new ways. We explore next-generation service and
product concepts, and develop exploitable insights, tools,
and knowledge. Doors gives you a better understanding of
the design process, and will introduce you to scenarios
for services that meet emerging needs in new ways. You
will make new connections among innovative people and
organizations that you would never have met elsewhere."
------------------------------------------------------
Address: Wibauthuis, Wibautstraat 3 1091 GH, Amsterdam
The Netherlands T +31 20 596 3220 F +31 20 596 3202
Doors of Perception 2002. We are happy for this text to be
copied and distributed, as long as you include this
credit: "From Doors of Perception:
www.doorsofperception.com". Want to send us your comments?
Email flow@doorsofperception.com
O=c=O O=c=O O=c=O O=c=O
YES I AM GOING THERE
TO POUND THE PODIUM
AND YELL!
O=c=O O=c=O O=c=O O=c=O
-
001110100010100100000000
-
The best beer I have ever had is Pittock Heavy Ale from Mount Hood Brewery in Oregon. One of Michael Moores top 5 porter beers in the world and its named after a relative of mine!
I had some two summers ago (normally a winter beer but the brewery brewed us a couple of barrels for a familly reunion in Portland Oregon - no thats not where I am from - thats where some of my family went to years ago).
-
As an aside I may chip my grandma as she has become prone to the occasional wander off down the street by herself and has got quite a way into town. She 90 now she is. This would seriously help my parents find her when she goes walkabout. Would she know she had a chip? Not even if it was the size of a football - although everyone else may notice it under her transparent skin.
What other applications could we use for trackers?
-
Key concepts: Global Business Network, futurist scenarios,
biomimicry, new means of industrial production,
bioelectronics, artificial canine intelligence,
biosensors, biomaterials, bio-engineering, enzymatic
industrial chemistry, environmental footprints, life-cycle
analysis, tissue engineering, speech recognition, energy
requirements, home networks, child companion, robot pets,
toys, venture capital
Attention Conservation Notice: it's our new, howlingly
ambitious Viridian Design Contest.
Links: Global Business Network
Global Business Network are professional futurists.
Based in Emeryville, California with colleagues
and clients scattered worldwide, GBN are future
wonks nonpareil. GBN has always been interested in
Viridian activism, and GBN has now ventured to
commission their own Viridian Design Contest. This is
gonna get pretty good, folks.
As commercial futurati, GBN likes to throw seminars
called "learning journeys." They involve tours
of companies and production facilities, and
presentations by "GBN Interesting People" such as
myself, Laurie Anderson, Brian Eno, and even
more advanced thinkers (if such a thing is even possible).
Then there are futurist scenarios.
If you ever wondered why most science fiction novelists
write Galactic Empire trilogies, while Bruce Sterling
writes dense, spooky, complicated books in which
political campaign advisors have love affairs in Louisiana
with federal neuroscientists, well, suffice it to say that
Global Business Network has intellectual influence.
They were Global way before global was cool.
The next GBN event, starting in California in early
October, is "BIOFUTURES: An Introduction to the Science,
Technology and Business of Biotech."
In this case, we Viridians will be an object lesson.
We will be teaching GBN's astonished clients how we
Viridians speculate about advanced biotech
consumerism in a Viridian design context.
And GBN's attendees == venture-capital types,
generally, with the occasional policy wonk or bent
academic == will be the JUDGES of this contest. These
people wear nice suits. They sign big checks.
They start-up high-tech companies. If they send you
email and hire you, don't say you weren't warned.
"Okay," I hear you asking. "A Viridian design gig with
corporate futurist sponsorship. What's in it for me?"
Great question, sir, ma'am! The astounding prize in this
Viridian Contest is == a Sony Aibo Robot Dog!
Link here:
http://www.sonystyle.com/home....d=40658
That's right! It's an actual, no-kidding, commercially
available, sort of alive, robofuturistic, adorable
personal companion, *just for you.*
Tina Estes, our GBN/Viridian Spokesmodel, has just broken
that baby out of the styrofoam blocks. She'll insert some
batteries into its entrails and make sure it's not a
factory lemon. Then you get to take it home and KEEP IT!
Just imagine the stunned surprise, not to
say uncanny Frankenstein alarm, when your own
no-kidding cute brown bulldog-oid
2002 A.D. Sony AIBO ERS-31L comes
into your room to greet your friends, frolicking
and blinking and, eerily, *digitally photographing
any object it finds of interest.* Listen up,
Australians, Europeans, South Americans, Asians.
Global Business Network is a global network.
They'll cheerfully ship that expensive,
complicated robot anywhere on the planet.
Interested? Good! Because the Sony Aibo ERS-31L
robot entertainment unit, praiseworthy as he-she-or-it is,
is a mere shadow of our designer expectations. For
this Biofuture Robot Dog Contest, we want
you to imagine and design a similar
but *vastly more advanced doglike entity,* which
has *nothing to do with the Sony corporation
or their copyright lawyers.* This is no mere
cyberdog device of period plastic, iron and
silicon. This is a biofuturistic, green,
way out-there ribo-bio-bamboo "dog", which is
transorganic, biomimetic, Viridian, enzymatically
postindustrial, and tissue-engineered.
Don't pretend that you are replacing a real dog. That
effort is useless, and even the "robot entertainer"
Aibo doesn't do that. This is a roughly dog-shaped
bio-entity. It needs to enter some commercial
and cultural space which actual dogs and contemporary
robots cannot reach. What does a biofuturist paradog do
for tomorrow's consumer? What kind of society buys these
gizmos?
Why do people make them, what are they for, what
kind of future world would support this device?
Try to suggest some convincing answers == answers
that can snow real live venture capitalists!
And it's a toy. That's of vital importance.
The target is the age 9-12 demographic.
It's not for war, terror, prison, or home security,
tasty though those sinister applications may be.
We want parents buying this. It needs to
jump right off the shelf and into their loving arms.
Instructions need to be understandable by the
average 10-year-old. Parents will appropriate
disclaimers and assembly guides.
Entries might plausibly include:
Postindustrial biomaterials
Postindustrial assembly methods
Name of the pet
Price point
Functions
Instructions for use
Safety and User Warnings
Who makes it and why
Adorable Xmas-season Viridian fake dog ads
And don't forget the exquisite ecological awareness!
We are looking for a child-friendly guide-dog
to a *greener* biofuture, with biosensors, industrial
biotech, the reduced ecological footprint of a new
bioeconomy, bioenergy sources, and so forth.
Although I am not going, I'm paid nothing, and I'm not
judging this contest, I do have some briefing papers for
the upcoming GBN event here. These suggestive excerpts may
help nudge you into the proper design space.
Bioelectronics, biomaterials, enzymatic engineering,
agrobiotech, environmental bioremediation, and strange
things to do with tissuelike substances: these are the
topics your Contest Judges will be studying at their event
this October. Present this in appropriate lingo, get under
their imaginative skin, and you, Viridian Designer,
are gonna be walkin' the robot dog.
This contest ends September 30, 2002.
BIOELECTRONICS
By integrating chemical and physical
devices such as silicon chips,
cantilevers, and carbon-based structures,
we can control the nanoscale patterning
of hybrid electronic devices... Antibodies
that adhere to metal can create biological
molds and patterns for electronic devices...
Organic electroluminescent displays and
chemical sensors... The inherent
smallness and precise interactions of
biological molecules can dramatically
reduce the size of circuit patterns...
BIOMATERIALS
Naturally-evolved materials for engineered,
intentional applications... ultra-strong,
light-weight, such as spider silks
synthesized in bacterial cells
ENZYMATIC ENGINEERING
Replace industrial manufacturing with
room-temperature enzymatic sustainable
processes. No acids, phosphorous, or
hazardous metal wastes... enzymes
have evolved to catalyze chemical
reactions at blood heat while the
typical industrial equivalent might
require several thousand degrees Centigrade.
Enzymes such as lipases, proteases,
cullulases and amylases are substituted
for noxious high-energy industrial chemistry.
Environmentally friendly, highly efficient
and cost-effective.
AGRICULTURAL BIOTECHNOLOGY
Crops reengineered for greater ranges
of environmental conditions, temperature
and moisture extremes... Molecular tuning
of oils, fats, proteins and carbohydrates,
alterations in leaf, petal, stem, branch,
root and seed structure, modified
breeding and growth cycles.
ENVIRONMENTAL REMEDIATION
Oil spills, contaminated soil, water and air, arising
from the unregulated use of of technologies
since the Industrial Revolution... Microbial
cleaner-organisms for industrial effluent,
groundwater, petrochemicals... A genetically
engineered microbe consumes target waste
over a discrete time window, then dies...
TISSUE ENGINEERING
Focused on the construction of
new tissues and organs as replacement
parts for diseased and aging body parts.
Using the skill and knowledge of cell
biologists, molecular biologists,
biomaterial engineers and CAD designers,
tissue engineers have set out to grow
liver, bone, muscle, cartilage, heart
muscles and pancreatic tissues.
O=c=O O=c=O
ARF ARF
O=c=O O=c=O
-
I had my old Datafort maps that you could netrun around world and click onto grids that would take you to websites but was not really city based as you mean. Have not built a whole city myself yet - but I do have a large Croydon project filed away somewhere. I should dig it out and publish it someday.
Agamemnon - what was the Dover project?
-
Excellent start from the delectable Chrysalis! Please PM her if you have any images you wish to contribute.
-
Quote (acehunter @ Aug. 30 2002,00:21) My account is easier to edit, what more can you ask for? I could ask for the software to be free! Actually the banner advertising has paid for it which is why its there - to generate money to build and improve the site!
I could also ask for some minor improvements in the admin side of the software but from the users side it should be a ton better which is why we made the move.
-
Not heard of this myself -anyone?
Viridian Note 00341
in Viridian
Posted
Key concepts: web activism, non-governmental
organizations, conventions, meetings, Cory Doctorow,
house party at Viridian Vatican
Attention Conservation Notice: A whole lot of links
and events vaguely having to do with web activism.
Cut to chase, come to house party, network, drink some
beer.
*******************************************
Entries in the Biofuture Robot Dog Contest:
From: Laura Sterling
http://www.viridiandesign.org/contests/laura.html
From: Mark Simpkins <mark*nodalpoints.org>
http://www.nodalpoints.org/viridian/index.html
From: Paul Jimenez <pj*place.org>
http://www.place.org/~pj/ROVER.txt
From: Giles Turnbull <giles*gorjuss.com>
http://gilest.org/242
From: david rice <david*futurefeedforward.com>
http://futurefeedforward.com/dingostroller.html
From: Duncan Stewart <stewarts*stewarts.org>
http://www.stewarts.org/viridian/gbn/watson.htm
From: David Bergman <bergman*cyberg.com>
http://cyberg.com/viridian/ddawg.htm
From: Eric Nehrlich <nehrlich*alum.mit.edu>
http://www.nehrlich.com/viridian_aromaker.html
From: "Matt Jones" <matt*blackbeltjones.com>
http://www.blackbeltjones.com/vonneumann
From: Dave Phelan <dphelan*pavilion.co.uk>
http://www.btinternet.com/~dphelan/viridian/futuredog.html
"Here's my entry, designed with the aid of my partner,
Katie Player. I guess it falls into the 'Adorable Xmas-
season Viridian fake dog ads' category. 'What sort of
society buys this sort of thing?' Well, *ours* of course."
Dave Phelan CCIE#3590 ICQ: 50180416
GSM: +44 (0)7740 186987
dphelan*pavilion.co.uk Blog:
http://www.btinternet.com/~dphelan
"It may be the warriors that get the glory, but it's the
engineers that build society" -- B'lanna Torres,
ST:Voyager 7.10
This contest ends in four days: September 30, 2002.
****************************************************
Links:
The "MetaFilter" collaborative weblog maps the
zipcodes of its members in the USA.
http://metatalk.metafilter.com/mefi/2610
"Smart Mobs, the Next Social Revolution."
http://www.smartmobs.com/index.html
"Globalthink," some kinda vague, networked,
lefty, bureaucratic, menace to all things everywhere.
http://www.nypost.com/postopinion/opedcolumnists/57663.htm
The military vaporware version. Don't just network
live in real-time: blow stuff up, too.
http://www.businessweek.com/technol....929.htm
Electronic Frontier Foundation: old-skool ad-hocratic
cyberNGO from before it was cool.
http://www.eff.org/
Cory Doctorow of EFF is in town. He's speaking here.
And he's got a lot on his mind.
http://effaustin.org/cory.html
Cory writes science fiction. Plus, he is a big wheel
in my favorite weblog. He's staying at the Viridian
Vatican because we Viridians aid and abet him and
his ilk. We ARE the ilk. We exceed in ilkiness.
http://www.boingboing.net/
Source: Art McGee
Date: Tue, 17 Sep 2002 22:08:08 +0000 (UTC)
From: Art McGee <amcgee@freeshell.org>
Subject: NPO/NGO Media & Technology Calendar [09/17/02 -
12:40 PST]
==========================================================
NPO/NGO Media & Technology Calendar [09/17/02 - 12:40 PST]
==========================================================
Networking the Networks:
Public Access Computing in Arizona
Mesa, AZ, USA
September 17, 2002
http://www.americaconnects.net/new/default.asp?subid=33
CivicNet '02:
Build Local Power with Community Networks
Internet, Cyberspace, Universe
September 18-October 2, 2002
http://www.civicnet02.net
Community Connections:
Prospects for Electronic Democracy
Pittsburgh, PA, USA
September 20-21, 2002
http://www.cmu.edu/insites
Media, Technology, and Social Change:
Broadening the Base, Building the Movement
Boston, MA, USA
September 20-21, 2002
http://www.ltc.org/gbbn/techconf
Open Source Content Management
Berkeley, CA, USA
September 25-27, 2002
http://www.oscom.org/conferences/berkeley2002
The Web of Change
Cortes Island, British Columbia, Canada
September 26-29, 2002
http://www.mediathatmatters.org/webofchange2002
Labor's Voices/LaborTech
New York, NY, USA
September 26-28, 2002
http://www.laborsvoiceslabortech.org
Midwest Regional Technology Conference:
Creating A Social Network
Minneapolis, MN, USA
September 27, 2002
http://www.c-can.org/2002conference.htm
Telecommunications Policy Research
Alexandria, VA, USA
September 28-30, 2002
http://www.tprc.org
United Nations:
Information and Communication Technologies Task Force
New York, NY, USA
September 30-October 1, 2002
http://www.unicttaskforce.org
Pull Focus ---> Pushing Forward:
Media Arts Connecting Culture and Community
Seattle, WA, USA
October 2-5, 2002
http://www.pullfocus.org
The New Media: Critical Approaches
Newcastle, Australia
October 3-4, 2002
http://www.octapod.org/newmediaconference
Dark Markets:
Infopolitics, Electronic Media and Democracy
Vienna, Austria, EU
October 3-4, 2002
http://darkmarkets.t0.or.at
Autonomous Media
Tucson, AZ, USA
October 3-6, 2002
http://www.consensus.net/autonomousmedia.html
Developing Country Access to Online Scientific Publishing
Trieste, Italy, EU
October 4-5, 2002
http://www.ictp.trieste.it/ejournals/meeting2002
Break the Media Blackout:
Media Democracy & the Struggle to End Poverty
Philadelphia, PA, USA
October 4-6, 2002
http://www.kwru.org/conference
Computer Professionals for Social Responsibility:
Shrinking World, Expanding Net
Cambridge, MA, USA
October 5, 2002
http://www.cpsr.org/conferences/annmtg02
Rural Telecommunications Congress:
Building Demand for Broadband
Des Moines, IA, USA
October 6-9, 2002
http://ruraltelecon.org/rtc02
Global Congress on Community Networking in the Digital Era
Montreal, Quebec, Canada
October 7-12, 2002
http://www.globalcn.org
World Summit on Internet and Multimedia:
Bridging the Digital Divide
Montreaux, Switzerland, EU
October 8-11, 2002
http://www.internetworldsummit.org
Electronic Networks & Democratic Engagement
Nijmegen, Netherlands, EU
October 9-12, 2002
http://baserv.uci.kun.nl/~jankow/Euricom
Union for Democratic Communications:
Democratic Communications and Social Justice
State College, PA, USA
October 10-13, 2002
http://www.udc.org
Race in Digital Space 2.0:
Race and New Media Technologies
Los Angeles, CA, USA
October 11-13, 2002
http://www.annenberg.edu/race
Internet Research 3.0: Net / Work / Theory
Maastricht, Netherlands, EU
October 13-16, 2002
http://www.aoir.org/2002
Advancing the Research Agenda on Open Source
Brussels, Belgium, EU
October 14, 2002
http://merit0227ts49.unimaas.nl/FLOSS/workshop
Technology Initiative Grant Conference
Chicago, IL, USA
Octber 16-18, 2002
http://lstech.org/workgroups/tech_conf_2002
Media Democracy Day
International, Global, Universe
October 18, 2002
http://www.mediademocracyday.org
http://www.mediademocracyday.org.uk
Web Design that Works for Everyone
Providence, RI, USA
October 18-19, 2002
http://www.adaptiveenvironments.org/webconference
Action Coalition for Media Education
Albuquerque, NM, USA
October 18-20, 2002
http://www.acmecoalition.org
New Orleans Book Fair:
The Intersection of Art Books, Zines and Print Publishing
New Orleans, LA, USA
October 26-27, 2002
http://www.nolabookfair.com
Circuit Riders/N-TEN Chicago Regional Conference
Chicago, IL, USA
October 31-November 1, 2002
http://www.nten.org/conferences-chicago
IMAGeNation Aboriginal Film and Video Festival
Vancouver, British Columbia, Canada
November 7-10, 2002
http://www.imag-nation.com
Doors of Perception:
The Design Challenge of Pervasive Computing
Amsterdam, Netherlands, EU
November 14-16, 2002
http://flow.doorsofperception.com
American Society for Information Science and Technology:
Information, Connections and Community
Philadelphia, PA, USA
November 18-21, 2002
http://www.asis.org/Conferences/AM02
Circuit Riders/N-TEN Boston Regional Conference
Boston, MA, USA
November 19-20, 2002
http://www.nten.org/conferences-boston
African Studies Association:
Africa in the Information and Technology Age
Washington, DC, USA
December 5-8, 2002
http://www.africanstudies.org/asa_papercalltheme.html
Technology Tools for Teaching and Learning
San Juan, Puerto Rico
December 8-11, 2002
http://www.technologytools.org
International Conference on Information Systems:
Virtual Community Informatics Workshop
Barcelona, Spain, EU
December 15, 2002
http://web.njit.edu/~bieber/vci-workshop-2002.html
International World Wide Web Conference
Budapest, Hungary
May 20-24, 2003
http://www2003.org
World Summit on the Information Society
Geneva, Switzerland, EU
December 10-12, 2003
http://www.itu.int/wsis
=====================================================
CopyLeft © 2002 by Art McGee <amcgee*freeshell.org>
All Bragging Rights Reserved. [09/17/02 - 12:40 PST]
=====================================================
O=c=O O=c=O O=c=O O=c=O O=c=O O=c=O
TURKEY CITY WRITERS WORKSHOP PARTY
SATURDAY NIGHT 9/28/02002 8PM +
SEND EMAIL FOR DIRECTIONS
O=c=O O=c=O O=c=O O=c=O O=c=O O=c=O